Psikhologicheskie Issledovaniya • ISSN 2075-7999
peer-reviewed • open access journal
      

 

Поликанова И.С., Сысоева О.В., Тоневицкий А.Г. Связь серотонинового транспортера (5НТТ) с развитием утомления

English version: Polikanova I.S., Sysoeva O.V., Tonevitskii A.G. Association between serotonin transporter (5HTT) and mental fatigue development
Московский государственный университет им. М.В.Ломоносова, Москва, Россия
Washington University School of Medicine, Saint Louis, USA

Сведения об авторах
Литература
Ссылка для цитирования


Исследовалось влияние длительной когнитивной нагрузки на развитие утомления по комплексу субъективных, поведенческих и электрофизиологических (ЭЭГ) параметров у носителей полиморфизмов гена 5НТТ (N = 52). Умственное утомление моделировалось с помощью непрерывного решения испытуемым когнитивных заданий в течение 2,5 часов. Показано, что длительная когнитивная нагрузка значимо отражается практически на всем комплексе показателей. Обнаружены значимые различия между носителями полиморфизмов LL и LS + SS гена 5НТТ в реакции выбора, а также по индексу утомления, отражающему отношение медленных ритмов мозга к быстрым. Полученные результаты свидетельствуют о положительной роли серотонина в развитии утомления.

Ключевые слова: утомление, когнитивная нагрузка, транспортер серотонина 5НТТ, электроэнцефалограмма, скорость реакции, индивидуальный альфа-ритм, индекс утомления

 

Исследование проблемы утомления насчитывает уже почти полтора века. Начавшись с исследований Ф.Эрисмана в области гигиены физического и умственного труда [Эрисман, 1877], она получила свое дальнейшее развитие в экспериментальной психологии в трудах таких исследователей, как Ф.Гальтон, Э.Крепелин, Г.Эббингауз, А.Бине и т.д. (см. [Леонова, 1994]). Весомый вклад в развитие проблемы утомления был сделан в психотехнике, основателем которой считается Г.Мюнстерберг. Данная проблема также широко рассматривалась в физиологии и психофизиологии И.М.Сеченовым, И.П.Павловым, Б.М.Тепловым, В.Д.Небылицыным. Как следствие, к настоящему моменту в области исследования утомления накоплено огромное количество данных как в психологии, так и в психофизиологии и биохимии. Несмотря на это, в настоящее время не существует общепринятого определения утомления, так же как и общей теории, описывающей механизм развития утомления. В психологических исследованиях под термином «утомление» довольно часто понимается определенное функциональное состояние, возникающее в результате интенсивной или длительной нагрузки и проявляющееся во временном нарушении ряда психических и физиологических функций человека, снижении эффективности и качества его деятельности [Непопалов и др., 2008].

В психофизиологии для анализа функциональных состояний часто используется такой метод, как спектральный анализ, отражающий динамику мозговых ритмов в различных состояниях и условиях. Во многих работах показано, что спектральные показатели электроэнцефалограммы (ЭЭГ) характеризуются значимыми изменениями в различных функциональных состояниях, в том числе и при утомлении [Кропотов, 2010; Данилова, 2004; Александров, 2007; Boksmen et al., 2005; Jap et al., 2009; Cheng et al., 2011; Trejo et al., 2005; Lal et al., 2007]. Многие исследователи отмечают значимые изменения спектральных характеристик ЭЭГ, отражающиеся, как правило, в увеличении мощности медленных ритмов – альфа, тета и дельта; и снижении мощности быстрых ритмов – бета и гамма [Boksmen et al., 2005; Jap et al., 2009; Cheng et al., 2011; Trejo et al., 2005; Lal et al., 2007]. Некоторые авторы показали, что хорошим индикатором утомления является индекс, отражающий отношение мощности медленных ритмов к быстрым ((альфа + тета)/(бета)) [Jap et al., 2009; Cheng et al., 2011]. Ряд исследователей также отмечает, что при утомлении происходит снижение такого показателя ЭЭГ, как индивидуальная частота альфа-ритма, которая проявляется на ЭЭГ в виде остроконечного пика в диапазоне альфа-ритма при закрытых глазах [Angelakis et al., 2004; Klimesh, 1999; Jap et al., 2009].

В многочисленных исследованиях продемонстрирована связь между утомлением и уровнем концентрации определенных нейромедиаторов, преимущественно серотонина и дофамина [Blomstrand, 2001; Davis et al., 2000; Castell, 1999]. Концентрация данных веществ зависит от наличия тех или иных полиморфизмов, ассоциированных с транспортировкой и утилизацией этих нейромедиаторов, а также с плотностью рецепторов для них. Показано, что высокая концентрация серотонина ведет к увеличению скорости развития утомления из-за того, что серотонин играет важную роль в процессе сна [Meeusen et al., 2007; Newsholme et al., 1995]. Синтез серотонина происходит в основном в ядрах шва, которые иннервируют обширные области мозга, включающие кору больших полушарий, гиппокамп, бледный шар, миндалину, гипоталамус. В связи с этим значительные изменения концентрации серотонина могут иметь воздействие на многие структуры мозга. Ядра шва также влияют на активность мотонейронов [Nicholls et al., 2003], и недостаток серотонина может приводить к ослаблению их активности.

Переносчик серотонина (5-HT transporter gene, 5-НТТ) играет важную роль в трансмиссии серотонина в головном мозге, а также во многих периферических тканях. Он удаляет серотонин из синаптической щели и определяет величину и продолжительность сигнала на постсинаптической мембране. Одним из наиболее изученных полиморфизмов является 5HTTLPR (5-HTT gene-linked polymorphic region). Обычно выделяют два аллеля этого гена – короткий S и длинный L. При наличии одного или двух S-аллелей транскрипция 5-HTT снижается на 60–70% в головном мозге и на 30–40% в лимфобластах по сравнению с гомозиготой по L-аллелю [Dennis et al., 2004].

Гипотеза исследования

Основной гипотезой нашего исследования было предположение о том, что длительная когнитивная нагрузка, приводящая к развитию утомления, будет по-разному отражаться на психологических, поведенческих и психофизиологических показателях у носителей различных полиморфизмов гена 5НТТ. Мы предполагаем, что носители LL-полиморфизма будут обладать большей резистентностью к развитию утомления по сравнению с носителями более короткого S-аллеля – полиморфизмами LS и SS. Данная гипотеза основана на том, что LL-полиморфизм связан с большей транскрипцией 5НТТ, что в свою очередь ведет к большей его концентрации в головном мозге, а как следствие – высокой скорости удаления серотонина из синаптической щели. Меньшая концентрация серотонина, как было сказано выше, ассоциирована с меньшим развитием утомления.

Методы

Испытуемые

В данном исследовании приняли участие 52 испытуемых (мужчины-правши, средний возраст 20 ± 4 лет). Для данных испытуемых был проведен генетический анализ и определены полиморфизмы 5HTTLPR гена 5НТТ.

Задания на время реакции

В исследовании использовались три вида заданий на время реакции: простая зрительно-моторная реакция (ПЗМР), реакция выбора (РВ) и максимальный теппинг (МТ). В серии с ПЗМР от испытуемого требовалось как можно быстрее нажимать на «кнопку 1» при появлении красного крестика в центре экрана. В серии с РВ испытуемый должен был при появлении красного крестика в центре экрана нажимать также на «кнопку 1», а при предъявлении зеленого крестика – «кнопку 2». В серии с МТ испытуемый должен был нажимать «кнопку 1» с максимально возможной скоростью в течение одной минуты.

Для предъявления стимульного материала использовалась программа E-prime (версия 1.2). Стимулы предъявлялись на мониторе фирмы Dell с разрешением экрана 1280×1024 пикселей. Все стимулы предъявлялись на черном фоне. Фиксационная точка находилась в центре экрана в виде белого крестика (Courier New, размер 18).

Для ПЗМР и РВ заданий длительность предъявления фиксационной точки и стимула составляла от 500 до 1500 мс. В ПЗМР стимулом служил красный крестик в центре экрана (Courier New, размер 72). В РВ стимулом был красный крестик (Courier New, размер 72) и зеленый крестик (Courier New, размер 72), которые предъявлялись в случайной последовательности. В обоих заданиях перед выполнением основной серии испытуемые выполняли тренировочную серию из 10 стимулов. Основная серия же состояла из 70 стимулов. При анализе данных учитывались стимулы только из основной серии. В максимальном теппинге испытуемые нажимали на кнопку в течение 60 секунд. Через 60 секунд выполнение задачи автоматически останавливалось.

Запись ЭЭГ

Запись ЭЭГ в данном исследовании проводилась дважды: первый раз – в начале эксперимента, второй раз – после длительной когнитивной нагрузки. Запись ЭЭГ проводилась с помощью 256-канального энцефалографа фирмы EGI Electrical Geodesics с частотой оцифровки 500 Гц и референтом в вертексе. Фоновая ЭЭГ состояла из двух периодов записи – одной минуты с закрытыми глазами и одной минуты с открытыми глазами. После записи ЭЭГ проводился ремонтаж и фильтрация в полосе от 1 до 150 Гц и удалением 50 Гц наводки от сети. Каждая запись ЭЭГ была автоматически просканирована на наличие артефактов. Участки ЭЭГ с амплитудой более 200 мкВ в пределах окна в 640 мс отмечались как плохой канал, участки с амплитудой более 140 мкВ рассматривались как двигательный артефакт, а более 55 мкВ – как зрительный артефакт (Net Station software ).

Схема эксперимента

Схема эксперимента включала два одинаковых блока длительностью около 35 минут, разделенных серией когнитивных заданий, направленных в основном на внимание и рабочую память, длительностью около 2–2,5 часов. Таким образом, общая длительность эксперимента составляла примерно 4 часа. Каждый из двух блоков состоял из трех этапов: 1) заполнение психологического опросника САН (методика диагностики самочувствия, активности и настроения) [Доскин и др., 1973]; 2) запись ЭЭГ; 3) выполнение тестов на время реакции. Методика САН, предполагающая самооценку функционального состояния по 7-балльной шкале, выполнялась на компьютере непосредственно перед выполнением основных серий эксперимента (задания на время реакции и записи ЭЭГ).

Методы анализа данных

Для статистического анализа данных использовались пакет Statistica 8.0, а также пакет MatLab (версия R2007b). Для статистического анализа данных использовались ANOVA и t-тест для зависимых выборок. Для различных экспериментальных заданий (ПЗМР, РВ, МТ) и психологического опросника САН были подсчитаны средние значения и стандартные отклонения. Для реакции выбора определялось также количество ошибок.

Для анализа ЭЭГ использовались отрезки фоновой ЭЭГ длительностью 20 секунд с наименьшим содержанием артефактов в состояниях с закрытыми и открытыми глазами. Данные ЭЭГ были усреднены по пяти мозговым областям (лобной, центральной, височной, теменной и затылочной) для обоих полушарий. На основе данных ЭЭГ были рассчитаны частота индивидуального альфа-ритма (ИАР) и индекс утомления (ИУ). Индивидуальный альфа-ритм рассчитывался как частота, на которой наблюдается максимальная мощность альфа-ритма в диапазоне от 7 до 14 Гц. Подсчет индивидуального альфа-ритма проводился с помощью программы MatLab. Индекс утомления был рассчитан как отношение суммы мощностей медленных ритмов (альфа- и тета-ритмов) к мощности быстрого ритма (бета): ИУ = (альфа + тета) / (бета)) [Jap et al., 2009; Cheng et al., 2011].

Генетический анализ. Методика генотипирования 5HTT

Полиморфизм гена транспортера серотонина 5HTTLPR определяли с помощью полимеразной цепной реакции (ПЦР) и последующей идентификации различий длин продуктов [Ведяков и др., 2006].

Для постановки ПЦР использовали следующие праймеры:
5HTT – F 5' – CAATGTCTGGCGCTTCCCCTACATAT - 3'
5HTT – R 5' – GACATAATCTGTCTTCTGGCCTCTCAAG - 3'

Для аллеля L ожидаемая длина продукта амплификации 300 п.о., для аллеля S – 256 п.о.

ПЦР проводили по следующей программе:
1. 94 ºС – 1 минута – 1 цикл.
2. 94 ºС – 30 секунд, 61 ºС – 1 минута, 72 ºС – 1 минута; – 35 циклов.
3. Хранение: +10 ºС.

Детекцию продуктов проводили с помощью электрофореза в 2%-ном агарозном геле. Гель готовили на ТАЕ-буфере (0,2 М Трис, 0,1 М Ледяная уксусная кислота, 0,5 М ЭДТА pH 8.0). Электрофорез проходил при напряжении 100 V в течение 30 минут с охлаждением. Результат детектировали на трансиллюминаторе ТСР 15 М (Vilber lourmat) с помощью системы видеодетекции DNA Analyzer.

Результаты

По данным генетического анализа гена 5НТТ выборка испытуемых была поделена на следующие группы: наличие полиморфизма LL – 25 , LS – 18 человек, SS – 9 человек. Носители полиморфизмов LS и SS были объединены в одну группу на основе литературных данных, показывающих, что наличие даже одного S-аллеля ведет к снижению транскрипции 5-HTT на 60–70%.

Диагностика состояния (методика САН)

Статистический анализ (t-тест для зависимых выборок) показал, что после длительной когнитивной нагрузки наблюдается значимое снижение баллов по шкалам Самочувствие, Активность и общему баллу (табл. 1). Значимых различий между группами LL и LS + SS не наблюдалось. Таким образом, мы можем заключить, что длительная когнитивная нагрузка приводит к субъективному ухудшению самочувствия и снижению активности, что принципиально не зависит от наличия определенных полиморфизмов гена 5НТТ.

Таблица 1
Показатели методики САН (до утомления / после утомления)

Носители полиморфизма
гена 5НТТ
Самочувствие Активность Настроение Общий балл
LL 5,4/4,6** 5/4,2** 5,3/5,2 5,2/4,7*
LS + SS 5,5/4,6** 5/4,2** 5,5/5,3 5,3/4,7**

Поведенческие показатели

Простая зрительно-моторная реакция. Статистический анализ ANOVA показал наличие значимого замедления времени простой зрительно-моторной реакции после длительной когнитивной нагрузки (F(1,50) = 9,420; p < 0,004). Значимой разницы между группами носителей полиморфизмов LL и LS + SS не наблюдается. При этом следует отметить, что носители LL-полиморфизма характеризуются намного меньшей скоростью реакции по сравнению с группой LS + SS, но только на уровне тенденции (табл. 2).

Таблица 2
Простая зрительно-моторная реакция: межгрупповые различия (оценка по t-критерию)

 

Носители полиморфизма
гена 5НТТ
Состояния р-уровень
значимости
1 2
LL 234 (23) 244 (28) 0,027
LS + SS 225 (17) 236 (26) 0,048

 

Примечания. Состояние 1 – в начале эксперимента; состояние 2 – после длительной когнитивной нагрузки. В таблице приведены средние значения времени реакции, в скобках указаны стандартные отклонения.


Реакция выбора. Статистический анализ методом ANOVA (анализ вариативности) показал наличие значимого ускорения времени реакции выбора после длительной когнитивной нагрузки на всей выборке (F(1,50) = 11,233; p < 0,002). По результатам ANOVA, группы носителей полиморфизмов LL и LS + SS значимо различаются по времени реакции выбора (F(1,50) = 5,146; p < 0,03). Носители LL-полиморфизма характеризуются значимо меньшим временем реакции по сравнению с носителями LS + SS полиморфизмов (табл. 3). При этом тенденция к изменению времени реакции у обеих групп одинакова, что говорит о физиологической предрасположенности к скорости реагирования у носителей определенных полиморфизмов. По результатам ANOVA выявлено значимое увеличение количества ошибок после когнитивной нагрузки на общей выборке (F(1,50) = 8,5256; p < 0,006), однако разницы между носителями разных полиморфизмов по количеству ошибок не найдено (табл. 4).

Таблица 3
Межгрупповые различия по времени реакции выбора (оценка по t-критерию)

 

Носители полиморфизма
гена 5НТТ
Состояния р-уровень
значимости
1 2
LL 437 (58) 421 (50) 0,030
LS + SS 405 (51) 388 (60) 0,022

 

Примечания. Состояние 1 – в начале эксперимента; состояние 2 – после длительной когнитивной нагрузки. В таблице приведены средние значения времени реакции выбора, в скобках указаны стандартные отклонения.


Таблица 4
Межгрупповые различия по количеству ошибок при реакции выбора (оценка по t-критерию)

Носители полиморфизма
гена 5НТТ
Состояния р-уровень
значимости
1 2
LL 5,64 6,8 0,021
LS + SS 6,04 7 0,073

Примечания. Состояние 1 – в начале эксперимента; состояние 2 – после длительной когнитивной нагрузки. В таблице приведено среднее количество ошибок.


Максимальный теппинг. Двухфакторный анализ ANOVA показал значимое взаимодействие между факторами «время» (до и после утомления) и «тип полиморфизма» (LL или LS + SS): F(1,27) = 10,408; p < 0,004. Это говорит о том, что у носителей разных типов полиморфизмов скорость максимального теппинга при утомлении значимо различается. Носители S-аллеля (LS и SS) характеризуются значимым снижением скорости (F(1,11) = 10,828; p < 0,007) после когнитивной нагрузки, тогда как у носителей LL-полиморфизма наблюдается увеличение скорости, но статистически не значимое (табл. 5).

Таблица 5
Межгрупповые различия по скорости максимального теппинга (оценка по t-критерию)

Носители полиморфизма
гена 5НТТ
Состояния р-уровень
значимости
1 2
LL 178(18) 171(17) 0,105
LS + SS 164(16) 173(17) 0,007


Результаты электроэнцефалографии

Частота индивидуального альфа-ритма (ИАР). Четырехфакторная модель ANOVA показала отсутствие значимого различия между группами LL и LS + SS по частоте индивидуального альфа-ритма (ИАР) после длительной когнитивной нагрузки. Однако носители S-аллеля характеризуются значимым уменьшением ИАР в правом полушарии (F(1,23) = 5,097; p < 0,04), тогда как у LL полиморфизма такого уменьшения не наблюдается.

В табл. 6 представлены средние и стандартные отклонения показателя ИАР для обеих групп – носителей полиморфизмов гена 5НТТ (LL и LS + SS) до и после утомления. Результаты t-теста показали, что носители LL-полиморфизма характеризуются незначительным изменением данного показателя. Носители же S-аллеля (LS и SS) характеризуются значимым уменьшением ИАР в височной области правого полушария (табл. 6).

Таблица 6
Межгрупповые различия по частоте индивидуального альфа-ритма (ИАР)

Области мозга ИАР, Гц p-уровень значимости
Состояние 1 Состояние 2
M SD M SD  
Носители LL-полиморфизма
Лобная левая 9,83 1,05 9,74 0,99 0,528
Лобная правая 10 0,9 9,83 1,14 0,372
Центральная левая 10,04 0,87 9,84 1,12 0,500
Центральная правая 9,92 0,98 9,76 1,06 0,420
Теменная левая 10,14 0,92 10,12 0,92 0,744
Теменная правая 10,23 0,91 10,06 0,83 0,102
Височная левая 9,98 0,84 9,85 0,93 0,528
Височная правая 9,98 0,89 9,93 0,83 0,396
Затылочная левая 10,28 1,07 10,07 0,86 0,306
Затылочная правая 10,22 0,92 10,07 0,78 0,157
Носители (LS + SS)-полиморфизмов
Лобная левая 9,71 0,91 9,49 1,04 0,458
Лобная правая 9,7 0,95 9,44 0,98 0,241
Центральная левая 9,49 0,98 9,49 1,14 0,732
Центральная правая 9,61 0,9 9,39 1,07 0,361
Теменная левая 9,73 0,97 9,75 1,06 0,977
Теменная правая 10,1 0,85 9,74 1,04 0,097
Височная левая 9,72 1,01 9,6 1,06 0,607
Височная правая 9,94 0,8 9,58 0,97 0,040
Затылочная левая 9,85 0,85 9,58 0,89 0,179
Затылочная правая 10,05 0,82 9,64 0,89 0,086

Примечания. В таблице приведены средние и стандартные отклонения частоты индивидуального альфа-ритма. M – среднее, SD – стандартное отклонение. Состояние 1 – в начале эксперимента; состояние 2 – после длительной когнитивной нагрузки.


Индекс утомления. В таблице 7 представлены средние и стандартные отклонения индекса утомления для групп LL и LS + SS до и после утомления. Четырехфакторная модель ANOVA показала, что носители полиморфизма гена 5НТТ значимо различаются между собой по индексу утомления (F(1,37) = 6,7863; p < 0,02). Носители полиморфизма LL характеризуются значимо меньшим индексом утомления по сравнению с носителями LS и SS полиморфизмов как до, так и после утомления (F(4,148) = 2,7487; p < 0,03). При этом по динамике утомления LL-носители характеризуются значимым увеличением индекса утомления в обеих центральных и левой теменной областях. Носители S-аллеля характеризуются значимым увеличением индекса утомления во всех областях, кроме левой лобной области.

Таблица 7
Индекс утомления

Области мозга Индекс утомления р-уровень значимости
Состояние 1 Состояние 2
M SD M SD
Носители LL-полиморфизма
Лобная левая 2,98 1,75 3,99 3,33 0,121
Лобная правая 5,83 1,56 6,59 2,16 0,121
Центральная левая 2,38 1,3 3,46 2,74 0,034
Центральная правая 2,34 1,32 3,57 1,88 0,000
Теменная левая 2,23 1,33 3,72 2,73 0,003
Теменная правая 3,29 2,86 4,13 3,16 0,301
Височная левая 2,13 1,14 2,93 1,84 0,070
Височная правая 2,08 1,39 2,96 2,79 0,088
Затылочная левая 2,39 1,47 2,93 1,86 0,109
Затылочная правая 2,19 1,24 2,83 1,83 0,121
Носители (LS + SS)-полиморфизмов
Лобная левая 5,1 3,04 5,22 2,72 0,113
Лобная правая 7,54 2,99 7,91 2,83 0,019
Центральная левая 3,85 2,87 4,25 1,85 0,049
Центральная правая 3,97 3 5,25 2,76 0,002
Теменная левая 4,41 3,39 5,76 3,19 0,003
Теменная правая 5,69 4,09 7,34 4,25 0,004
Височная левая 3,54 2,51 4,55 2,5 0,002
Височная правая 3,76 2,65 4,76 2,76 0,003
Затылочная левая 4,47 3,21 5,32 3,04 0,031
Затылочная правая 4,09 2,82 5,15 2,66 0,007

Примечания. В таблице приведены средние и стандартные отклоненияя индекса утомления. M – среднее, SD – стандартное отклонение. Состояние 1 – в начале эксперимента; состояние 2 – после длительной когнитивной нагрузки.

Обсуждение

Результаты исследования показали, что после длительной когнитивной нагрузки наблюдается субъективное ухудшение самочувствия и снижение активности как у носителей полиморфизма LL, так и у носителей полиморфизмов LS и SS. Многие авторы отмечают, что после длительной когнитивной деятельности испытуемые себя чувствуют намного хуже, чем до нее [Wijesuriya et al., 2007]. Так, Трейо обнаружил, что после трех часов арифметических задач субъективная оценка по шкалам энергичность и спокойствие значимо снижаются, а значение по шкале усталость – значимо возрастает [Trejo et al., 2005]. Таким образом, можно заключить, что длительная когнитивная нагрузка отражается одинаково на изменении субъективного самочувствия в сторону ухудшения независимо от наличия того или иного полиморфизма гена 5НТТ.

Выявлено значимое влияние длительной когнитивной нагрузки на динамику времени реакции в различных пробах, а также значимое различие между носителями разных полиморфизмов по скорости реакции. Было показано значимое снижение скорости простой зрительно-моторной реакции, что свидетельствует о развитии утомления [Lorist et al., 2000; Boksem et al., 2006; Trejo et al., 2005]. Также было обнаружено значимое увеличение скорости реакции выбора при одновременном увеличении количества ошибок, что также говорит о развитии утомления [Wickelgren, 1977; Wood et al.,1976; Sternberg, 2004].

Некоторые авторы ранее установили, что при реакции выбора после длительной когнитивной нагрузки наблюдается не увеличение, как в случае с ПЗМР, а уменьшение времени реакции (т.е. увеличение скорости), и вместе с этим возрастает количество ошибок. Этот эффект был назван «компромиссом скорости и точности» [Wickelgren, 1977;  Wood et al., 1976; Sternberg, 2004; Osman, 2000]. Разные исследователи предлагали несколько теорий объяснения этого феномена. Одной из основных является теория о том, что с увеличением времени выполнения задания, то есть с возрастанием утомления, происходит смещение отношения между контролируемыми ответами на стимул и случайными ответами на него. Время латентной реакции при случайном ответе гораздо короче, чем при контролируемом, а доля случайных ответов увеличивается по мере утомления.

Таким образом, при нарастании утомления происходит уменьшение скорости ответа и возрастание количества ошибок [Ollman, 1966; Yellott, 1971]. Еще одной теорией, объясняющей уменьшение времени реакции выбора после длительной когнитивной нагрузки является гипотеза о том, что во время выполнения задания у испытуемого постоянно копится информация об уже выполненных заданиях, что позволяет ему быстрее отвечать на стимул, но из-за влияния утомления на когнитивную сферу происходит увеличение количества ошибок [Knight, 1974]. В максимальном теппинге статистический анализ не выявил значимых изменений в скорости реагирования на общей выборке.

При анализе различий между группами носителей отдельных полиморфизмов были также получены значимые результаты. В частности, полиморфизм LL характеризуется гораздо меньшей скоростью реагирования в заданиях ПЗМР (но различия статистически незначимы), а также значимо меньшей скоростью реагирования в заданиях РВ по сравнению с полиморфизмами LS и SS. Динамика времени реакции в обоих заданиях у LL и LS + SS групп одинакова. Таким образом, можно констатировать тот факт, что носители разных полиморфизмов гена 5НТТ различаются в заданиях ПЗМР и РВ не по скорости развития утомления, а по физиологической предрасположенности к определенному типу реагирования. В пользу этого факта также говорит динамика увеличения ошибок, которая у обеих групп одинакова.

Статистический анализ по данным максимального теппинга показал, что две группы носителей разных полиморфизмов характеризуются значимо различной динамикой изменения скорости реагирования. Носители LL-полиморфизма характеризуются увеличением, хотя статистически незначимым, скорости после длительной когнитивной нагрузки, тогда как носители S-аллеля характеризуются значимым замедлением реагирования. В состоянии утомления максимальный теппинг у обеих групп становится примерно одинаковым.

Максимальный теппинг отражает моторный компонент реакции и не зависит от скорости когнитивных процессов, он связан только с физиологической способностью к мышечному сокращению, которое, в свою очередь, зависит от активации мотонейронов коры головного мозга. Простая зрительно-моторная реакция включает в себя, помимо моторного компонента, также информационный компонент – восприятие стимула. Реакция выбора включает в себя, помимо вышеперечисленных компонентов – моторного и информационного, также когнитивный компонент – процесс оценки и принятия решения, какую кнопку нажать.

В настоящем исследовании мы получили, что в заданиях ПЗМР время реакции у двух групп (LL и LS + SS) различается статистически незначимо. В заданиях РВ наблюдается значимое различие двух групп носителей разных полиморфизмов. Это может свидетельствовать о том, что у носителей LL-полиморфизма информационные и когнитивные процессы осуществляются медленнее по сравнению с носителями S-аллеля. В максимальном теппинге группы характеризуются разнонаправленной динамикой изменения скорости реакции до и после утомления, что может говорить о меньшем развитии утомления у LL-носителей на уровне мотонейронов. Родригес показал, что изменения в максимальном теппинге имеют центральное происхождение [Rodrigues et al., 2009]. Таким образом, увеличение скорости в максимальном теппинге связано с большей активацией мотонейронов в головном мозге.

Полученные результаты могут свидетельствовать о положительной роли серотонина в обеспечении протекания информационной обработки. Об этом говорит тот факт, что носители полиморфизмов, ассоциированных с большей концентрацией серотонина в головном мозге (LS и SS), характеризуются большей скоростью в заданиях ПЗМР и РВ по сравнению с носителями LL-полиморфизма, связанного с меньшей концентрацией серотонина. При этом более значимые межгрупповые различия получены по времени реакции выбора (РВ), которая требует гораздо большей информационной обработки.

Длительная когнитивная нагрузка также значимо отражается на частоте индивидуального альфа-ритма (ИАР). Статистический анализ выявил значимо разную динамику данного показателя в левом и правом полушариях. На общей выборке было показано значимое уменьшение ИАР в правом полушарии после когнитивной нагрузки, чего не наблюдается в левом полушарии. На уровне отдельных полиморфизмов были также выявлены значимые различия. Носители S-аллеля характеризуются большим снижением ИАР после утомления, преимущественно в правом полушарии, хотя значимое снижение наблюдается только в правой височной области. Тогда как у носителей полиморфизма LL такого значимого снижения обнаружено не было. У носителей полиморфизмов LS и SS снижение ИАР в среднем наблюдается с 9,79 Гц до 9,57 Гц. У полиморфизма LL – с 10,06 Гц до 9,93 Гц. Таким образом, мы показали, что люди с генотипом LL характеризуются не только меньшим снижением ИАР, но и более высокой его частотой как до, так и после утомления.

В ряде исследований было показано, что пик альфа-ритма положительно коррелирует с такими процессами, как внимание, память, скорость сенсорной обработки [Angelakis et al., 2004; Klimesh, 1996, 1997, 1999]. Климеш показал, что испытуемые с высокими мнестическими способностями и высокой скоростью обработки информации характеризуются частотой альфа-пика в среднем на 1 Гц большей по сравнению с контрольной группой [Klimesh, 1996]. Испытуемые со сниженными мнестическими способностями характеризуются снижением пика альфа-ритма во время выполнения заданий на память, а испытуемые с высокими мнестическими способностями характеризуются стабильностью пика альфа-ритма в различных условиях [Klimesh, 1997]. При длительном выполнении когнитивных заданий многие авторы отмечают снижение индивидуальной частоты альфа-ритма [Angelakis et al., 2004; Klimesh, 1999; Jap et al., 2009; Lal et al., 2007].

Индекс утомления отражает отношение медленных мозговых ритмов к быстрым ((альфа + тета) / бета). Буди Томас Джап в своем исследовании показал, что отношение (альфа + тета) / бета более сильно увеличивается по сравнению с другими индексами (альфа / бета, (альфа + тета) / (альфа + бета), тета / бета) и является наиболее чувствительным к изменениям функционального состояния [Jap et al., 2009]. Ченг с соавторами также показали, что индекс (альфа + тета)/бета показывает более значимое изменение после длительной когнитивной нагрузки по сравнению с другими индексами (тета / альфа, бета / альфа) [Cheng et al., 2011].

В нашем исследовании по показателям индекса утомления были обнаружены значимые различия между носителями разных полиморфизмов. Значимое увеличение индекса утомления у носителей полиморфизма LL было обнаружено только в обеих центральных и левой теменной областях. Индекс утомления у носителей полиморфизма LL в среднем увеличился с 2,78 до 3,71. У носителей же S-аллеля (LS и SS) наблюдается выраженное значимое увеличение индекса утомления практически во всех областях, кроме лобной левой области. В среднем у носителей S-аллеля индекс утомления увеличился с 4,64 до 5,55. Таким образом, мы видим, что у носителей полиморфизмов LS и SS как в фоне, так и после утомления наблюдается значимо более высокий индекс утомления по сравнению с носителями генотипа LL. Это может говорить о том, что у носителей полиморфизмов LS и SS более высокая мощность медленных ритмов (альфа- и тета-ритмов), а также низкая мощность быстрых ритмов (бета). В различных исследованиях было показано, что носители полиморфизма LL характеризуются более быстрым удалением серотонина из синаптической щели по сравнению с носителями S-аллеля (LS и SS). Поэтому в целом концентрация серотонина у них меньше. Было также показано в различных работах, что увеличение концентрации серотонина ведет к развитию утомления [Davis et al., 2000; Weicker et al., 2001; Meeusen et al., 2007]. Таким образом, наши результаты соответствуют литературным данным.

Выводы

1. Высокая концентрация серотонина положительно влияет на скорость развития утомления при длительной когнитивной нагрузке, что отражается на комплексе психофизиологических показателей: носители короткого S-аллеля (полиморфизмы LS и SS), ассоциированного с большей концентрацией серотонина, характеризуются значимым увеличением индекса утомления после нагрузки, а также значимым снижением частоты индивидуального альфа-ритма в правом полушарии.

2. Меньшая концентрация серотонина ассоциирована с меньшей скоростью простой зрительно-моторной реакции и реакции выбора как до, так и после длительной когнитивной нагрузки. При меньшей концентрации серотонина также наблюдается увеличение максимального теппинга. Это может говорить, с одной стороны, о положительной роли серотонина в информационной обработке, а с другой – о том, что высокая концентрация серотонина ведет к более быстрому развитию утомления.

3. Высокая концентрация серотонина отрицательно связана с параметрами индивидуального альфа-ритма: полиморфизмы LS и SS характеризуются меньшим значением индивидуального альфа-ритма в фоне и сильным его уменьшением после длительной когнитивной нагрузки, преимущественно в правом полушарии. Носители же LL-полиморфизма характеризовались более высоким и стабильным индивидуальным альфа-ритмом как до, так и после когнитивной нагрузки.

4. Полиморфизмы LS и SS, ассоциированные с высокой концентраций серотонина, характеризуются более высокими значениями индекса утомления и обширным его увеличением почти во всех областях мозга после когнитивной нагрузки. У носителей полиморфизма LL индекс утомления и до и после когнитивной нагрузки был значимо ниже, чем у носителей полиморфизмов LS и SS, и после утомления увеличение индекса наблюдалось только в центральных областях. Это может говорить о том, что у носителей полиморфизма LL не происходит сильного увеличения мощности медленных ритмов, которые обычно связывают с уменьшением метаболической активности и развитием утомления.

Заключение

В настоящем исследовании мы в целом подтвердили нашу гипотезу о том, что длительная когнитивная нагрузка по-разному отражается на комплексе поведенческих и психофизиологических параметров у носителей различных полиморфизмов гена 5НТТ. Предположение же о том, что носители разных полиморфизмов будут значимо различаться по психологическим показателям после утомления, не нашло экспериментального подтверждения. Мы подтвердили нашу гипотезу о роли серотонина в развитии утомления после длительной когнитивной нагрузки, а также показали его положительную роль в информационной обработке.


Литература

Александров Ю.И. Психофизиология. М.: Питер, 2007.

Ведяков А.М., Тоневицкий А.Г., Сысоева О.В., Портнова Г.В., Иваницкий А. Анализ полиморфизма гена транспортера серотонина (5-HTTLPR) у спортсменов // Медико-биологические технологии повышения работоспособности в условиях напряженных физических нагрузок. М., 2006. Т. 2. С. 97–108.

Данилова Н.Н. Психофизиология. М.: Аспект пресс, 2004.

Доскин В.А., Лаврентьева Н.А., Мирошников М.П., Шарай В.Б. Тест дифференцированной самооценки функционального состояния // Вопросы психологии. 1973. No. 6. С. 141–145.

Зинченко Ю.П., Тоневицкий А.Г., Веракса А.Н., Исайчев С.А., Леонов С.В., Меньшикова Г.Я., Стрелков Ю.К., Сысоева О.В., Черноризов А.М. Психология спорта. М.: Изд-во Моск. ун-та, 2011.

Климов Е.А., Носкова О.Г. История психологии труда в России. М.: Изд-во Моск. ун-та, 1992.

Кропотов Ю.Д. Количественная ЭЭГ, когнитивные вызванные потенциалы мозга человека и нейротерапия. СПб: ЭЛБИ, 2010.

Леонова А.Б. Психодиагностика функциональных состояний человека. М.: Изд-во Моск. ун-та, 1994.

Небылицын В.Д. Психофизиологические исследования индивидуальных различий. М.: Наука, 1976.

Николлс Дж.Г., Мартин А.Р., Валлас Б.Дж., Фукс П.А. [Nicholls J.G., Martin A.R., Wallace B.G., Fuchs P.A.] От нейрона к мозгу. М.: УРСС, 2003.

Эрисман Ф.Ф. Профессиональная гигиена или гигиена умственного и физического труда. Спб., 1877.

Angelakis E. Peak alpha frequency: an electroencephalographic measure of cognitive preparedness // Clinical Neurophysiology. 2004. Vol. 115(4). P. 887–897.

Blomstrand E. Amino acids and central fatigue // Amino Acids. 2001. Vol. 20(1). P. 25–34.

Boksem M.A.S., Meijman T.F., Lorist M.M. Mental fatigue, motivation and action monitoring // Biological Psychology. 2006. Vol. 72(2). P. 123–132.

Castell L.M. The role of tryptophan in fatigue in different conditions of stress // Advances inExperimental Medicine and Biology. 1999.Vol. 467. P. 697–704.

Cheng Shyh-Yueh, Hsu Hong-Te. Mental fatigue measurement using EEG // Nota G. (Ed.). Risk Management Trends. ISBN: 978-953-307-314-9, InTech, 2011. doi: 10.5772/16376

Davis J.M., Alderson N.L., Welsh R.S. Serotonin and central nervous system fatigue: nutritional considerations // The American Journal of Clinical Nutrition. 2000. Vol. 72(2 Suppl). P. 573S–578S.

Dennis L., Murphy, Lerner A., Rudnick G., Lesch K. Serotonin transporter: Gene, genetic disorders, and pharmacogenetics // Molecular and Clinical Psychobiology. 2004. Vol. 4(2). P. 109–122.

Jap B.T. Using EEG spectral components to assess algorithms for detecting fatigue // Expert Systems with Applications. 2009. Vol. 36(2, Part 1). P. 2352–2359.

Klimesch W. EEG alpha and theta oscillations reflect cognitive and memory performance: a review and analysis // Brain Research. Brain Research Reviews. 1999. Vol. 29(2–3). P. 169–195.

Klimesch W. EEG-alpha rhythms and memory processes // International Journal of Psychophysiology. 1997. Vol. 26(1–3). P. 319–340.

Klimesch W. Memory processes, brain oscillations and EEG synchronization // International Journal of Psychophysiology. 1996.Vol. 24(1–2). P. 61–100.

Knight J.L., Kantowitz B.H. Speed-accuracy tradeoff in double stimulation: Effects on the first response // Memory and Cognition. 1974. Vol.   2(3). P. 522–532.

Lal S., Bekiaris E. The reliability of sensing fatigue from neurophysiology. Auswireless Conference, University of Technology, Sydney, 2007.

Lorist M.M., Boksem, M.A.S., Ridderinkhof, K.R. Impaired cognitive control and reduced cingulate activity during mental fatigue // Brain Research. Cognitive Brain Research. 2005. Vol. 24(2). P. 199–205.

Lorist M.M. Mental fatigue and task control: Planning and preparation // Psychophysiology. 2000. Vol. 37(5). P. 614–625.

Maarten A.S. Boksem, Meijman T.F. , Lorist M.M. Effects of mental fatigue on attention: An ERP study // Cognitive Brain Research. 2005. Vol. 25. P. 107 – 116.

Meeusen R., Watson P. Amino acids and the brain: do they play a role in “central fatigue”? // International Journal of Sport Nutrition and Exercise Metabolism. 2007. Vol. 17(Suppl). P. 37–46.

Newsholme E.A., Blomstrand E. Tryptophan, 5-hydroxytryptamine and a possible explanation for central fatigue // S.C. Gandevia, R.M. Enoka, A.J. McComas, D.G. Stuart, C.K. Thoma (Eds.). Advances in Experimental Medicine and Biology. London: Plenum Press, 1995. Vol. 384. P. 315–320.

Ollman R. Fast guess in choice reaction time // Psychonomic Science. 1966. Vol. 6. P. 155–156.

Osman A.  Mechanisms of speed–accuracy tradeoff: evidence from covert motor processes // Biological Psychology. 2000. Vol. 51(2–3). P. 173–199.

Rodrigues J.P., Mastaglia F.L., Thickbroom G.W., Rapid slowing of maximal finger movement rate: Fatigue of central motor control? // Experimental Brain Research. Experimentelle Hirnforschung. Expérimentation Cérébrale. 2009. Vol. 196(4). P. 557–563.

Sternberg S. Reaction-time experimentation. Psychology 600–301, Proseminar in Psychological Methods, University of Pennsylvania, 2004. http://www.psych.upenn.edu/~saul/rt.experimentation.pdf

Trejo L.J., Kochavi R., Kubitz K., Montgomery L.D., Rosipal R., Matthews B. EEG-based estimation of cognitive fatigue // Proceedings of the SPIE, Vol. 5797, Orlando, FL, 2005.

Weicker H., Strüder H.K. Influence of exercise on serotonergic neuromodulation in the brain // Amino Acids. 2001. Vol.  20(1). P. 35–47.

Wickelgren W.A. Speed-accuracy tradeoff and information processing dynamics // Acta Psychologica. 1977. Vol. 41(1). P. 67–85.

Wijesuriya N., Tran Y., Craig A. The psychophysiological determinants of fatigue // International Journal of Psychophysiology. 2007.Vol.  63(1). P. 77–86.

Wood C.C., Jennings J.R. Speed-accuracy tradeoff functions in choice reaction time: Experimental designs and computational procedures // Perception and Psychophysics. 1976. Vol.  19(1). P. 92–102.

Yellott J.I., Jr. Correction for fast guessing and the speed-accuracy tradeoff in choice reaction time // Journal of Mathematical Psychology. 1971. Vol.  8(2). P. 159–199.

 

Поступила в редакцию 16 мая 2012 г. Дата публикации: 20 августа 2012 г.

Сведения об авторах

Поликанова Ирина Сергеевна. Аспирант (2012), кафедра психофизиологии, факультет психологии, Московский государственный университет имени М.В.Ломоносова, ул. Моховая, д. 11, стр. 9, 125009 Москва, Россия.
E-mail: Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра.

Сысоева Ольга Владимировна. Кандидат психологических наук, Washington University School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110, USA.
E-mail: Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра.

Тоневицкий Александр Григорьевич. Доктор биологических наук, заведующий кафедрой физического воспитания и спорта,  Московский государственный университет имени М.В.Ломоносова, Ленинские горы, ГСП-1, 119991 Москва, Россия.
E-mail: Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра.

Ссылка для цитирования

Стиль psystudy.ru
Поликанова И.С., Сысоева О.В., Тоневицкий А.Г. Связь серотонинового транспортера (5НТТ) с развитием утомления. Психологические исследования, 2012, 5(24), 7. http://psystudy.ru. 0421200116/0043.

ГОСТ 2008
Поликанова И.С., Сысоева О.В., Тоневицкий А.Г. Связь серотонинового транспортера (5НТТ) с развитием утомления // Психологические исследования. 2012. Т. 5, № 24. С. 7. URL: http://psystudy.ru (дата обращения: чч.мм.гггг). 0421200116/0043.

[Последние цифры – номер госрегистрации статьи в Реестре электронных научных изданий ФГУП НТЦ "Информрегистр". Описание соответствует ГОСТ Р 7.0.5-2008 "Библиографическая ссылка". Дата обращения в формате "число-месяц-год = чч.мм.гггг" – дата, когда читатель обращался к документу и он был доступен.]

К началу страницы >>